• About Us
  • Disclaimer
  • Contact Us
  • Privacy Policy
Saturday, September 12, 2026
mGrowTech
No Result
View All Result
  • Technology And Software
    • Account Based Marketing
    • Channel Marketing
    • Marketing Automation
      • Al, Analytics and Automation
      • Ad Management
  • Digital Marketing
    • Social Media Management
    • Google Marketing
  • Direct Marketing
    • Brand Management
    • Marketing Attribution and Consulting
  • Mobile Marketing
  • Event Management
  • PR Solutions
  • Technology And Software
    • Account Based Marketing
    • Channel Marketing
    • Marketing Automation
      • Al, Analytics and Automation
      • Ad Management
  • Digital Marketing
    • Social Media Management
    • Google Marketing
  • Direct Marketing
    • Brand Management
    • Marketing Attribution and Consulting
  • Mobile Marketing
  • Event Management
  • PR Solutions
No Result
View All Result
mGrowTech
No Result
View All Result
Home Al, Analytics and Automation

How to Create a Bioinformatics AI Agent Using Biopython for DNA and Protein Analysis

Josh by Josh
September 8, 2025
in Al, Analytics and Automation
0
How to Create a Bioinformatics AI Agent Using Biopython for DNA and Protein Analysis

[ad_1]

class BioPythonAIAgent:
   def __init__(self, email="[email protected]"):
       self.email = email
       Entrez.email = email
       self.sequences = {}
       self.analysis_results = {}
       self.alignments = {}
       self.trees = {}
  
   def fetch_sequence_from_ncbi(self, accession_id, db="nucleotide", rettype="fasta"):
       try:
           handle = Entrez.efetch(db=db, id=accession_id, rettype=rettype, retmode="text")
           record = SeqIO.read(handle, "fasta")
           handle.close()
           self.sequences[accession_id] = record
           return record
       except Exception as e:
           print(f"Error fetching sequence: {str(e)}")
           return None
  
   def create_sample_sequences(self):
       covid_spike = "MFVFLVLLPLVSSQCVNLTTRTQLPPAYTNSFTRGVYYPDKVFRSSVLHSTQDLFLPFFSNVTWFHAIHVSGTNGTKRFDNPVLPFNDGVYFASTEKSNIIRGWIFGTTLDSKTQSLLIVNNATNVVIKVCEFQFCNDPFLGVYYHKNNKSWMESEFRVYSSANNCTFEYVSQPFLMDLEGKQGNFKNLREFVFKNIDGYFKIYSKHTPINLVRDLPQGFSALEPLVDLPIGINITRFQTLLALHRSYLTPGDSSSGWTAGAAAYYVGYLQPRTFLLKYNENGTITDAVDCALDPLSETKCTLKSFTVEKGIYQTSNFRVQPTESIVRFPNITNLCPFGEVFNATRFASVYAWNRKRISNCVADYSVLYNSASFSTFKCYGVSPTKLNDLCFTNVYADSFVIRGDEVRQIAPGQTGKIADYNYKLPDDFTGCVIAWNSNNLDSKVGGNYNYLYRLFRKSNLKPFERDISTEIYQAGSTPCNGVEGFNCYFPLQSYGFQPTNGVGYQPYRVVVLSFELLHAPATVCGPKKSTNLVKNKCVNFNFNGLTGTGVLTESNKKFLPFQQFGRDIADTTDAVRDPQTLEILDITPCSFGGVSVITPGTNTSNQVAVLYQDVNCTEVPVAIHADQLTPTWRVYSTGSNVFQTRAGCLIGAEHVNNSYECDIPIGAGICASYQTQTNSPRRARSVASQSIIAYTMSLGAENSVAYSNNSIAIPTNFTISVTTEILPVSMTKTSVDCTMYICGDSTECSNLLLQYGSFCTQLNRALTGIAVEQDKNTQEVFAQVKQIYKTPPIKDFGGFNFSQILPDPSKPSKRSFIEDLLFNKVTLADAGFIKQYGDCLGDIAARDLICAQKFNGLTVLPPLLTDEMIAQYTSALLAGTITSGWTFGAGAALQIPFAMQMAYRFNGIGVTQNVLYENQKLIANQFNSAIGKIQDSLSSTASALGKLQDVVNQNAQALNTLVKQLSSNFGAISSVLNDILSRLDKVEAEVQIDRLITGRLQSLQTYVTQQLIRAAEIRASANLAATKMSECVLGQSKRVDFCGKGYHLMSFPQSAPHGVVFLHVTYVPAQEKNFTTAPAICHDGKAHFPREGVFVSNGTHWFVTQRNFYEPQIITTDNTFVSGNCDVVIGIVNNTVYDPLQPELDSFKEELDKYFKNHTSPDVDLGDISGINASVVNIQKEIDRLNEVAKNLNESLIDLQELGKYEQYIKWPWYIWLGFIAGLIAIVMVTIMLCCMTSCCSCLKGCCSCGSCCKFDEDDSEPVLKGVKLHYT"
      
       human_insulin = "MALWMRLLPLLALLALWGPDPAAAFVNQHLCGSHLVEALYLVCGERGFFYTPKTRREAEDLQVGQVELGGGPGAGSLQPLALEGSLQKRGIVEQCCTSICSLYQLENYCN"
      
       e_coli_16s = "AAATTGAAGAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGAAGCAGCTTGCTGCTTTGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAATGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGCGTTAAGGTTAATAACCTTGGCGATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACAAAGACTGACGCTCAGGTGCGAAAGCGTGGGGAGCAAACA"
      
       sample_sequences = [
           ("COVID_Spike", covid_spike, "SARS-CoV-2 Spike Protein"),
           ("Human_Insulin", human_insulin, "Human Insulin Precursor"),
           ("E_coli_16S", e_coli_16s, "E. coli 16S rRNA")
       ]
      
       for seq_id, seq_str, desc in sample_sequences:
           record = SeqRecord(Seq(seq_str), id=seq_id, description=desc)
           self.sequences[seq_id] = record
      
       return sample_sequences
  
   def analyze_sequence(self, sequence_id=None, sequence=None):
       if sequence_id and sequence_id in self.sequences:
           seq_record = self.sequences[sequence_id]
           seq = seq_record.seq
           description = seq_record.description
       elif sequence:
           seq = Seq(sequence)
           description = "Custom sequence"
       else:
           return None
      
       analysis = {
           'length': len(seq),
           'composition': {}
       }
      
       for base in ['A', 'T', 'G', 'C']:
           analysis['composition'][base] = seq.count(base)
      
       if 'A' in analysis['composition'] and 'T' in analysis['composition']:
           analysis['gc_content'] = round(gc_fraction(seq) * 100, 2)
           try:
               analysis['molecular_weight'] = round(molecular_weight(seq, seq_type="DNA"), 2)
           except:
               analysis['molecular_weight'] = len(seq) * 650
      
       try:
           if len(seq) % 3 == 0:
               protein = seq.translate()
               analysis['translation'] = str(protein)
               analysis['stop_codons'] = protein.count('*')
              
               if '*' not in str(protein)[:-1]:
                   prot_analysis = ProteinAnalysis(str(protein)[:-1])
                   analysis['protein_mw'] = round(prot_analysis.molecular_weight(), 2)
                   analysis['isoelectric_point'] = round(prot_analysis.isoelectric_point(), 2)
                   analysis['protein_composition'] = prot_analysis.get_amino_acids_percent()
       except:
           pass
      
       key = sequence_id if sequence_id else "custom"
       self.analysis_results[key] = analysis
      
       return analysis
  
   def visualize_composition(self, sequence_id):
       if sequence_id not in self.analysis_results:
           return
      
       analysis = self.analysis_results[sequence_id]
      
       fig = make_subplots(
           rows=2, cols=2,
           specs=[[{"type": "pie"}, {"type": "bar"}],
                  [{"colspan": 2}, None]],
           subplot_titles=("Nucleotide Composition", "Base Count", "Sequence Properties")
       )
      
       labels = list(analysis['composition'].keys())
       values = list(analysis['composition'].values())
      
       fig.add_trace(
           go.Pie(labels=labels, values=values, name="Composition"),
           row=1, col=1
       )
      
       fig.add_trace(
           go.Bar(x=labels, y=values, name="Count", marker_color=['red', 'blue', 'green', 'orange']),
           row=1, col=2
       )
      
       properties = ['Length', 'GC%', 'MW (kDa)']
       prop_values = [
           analysis['length'],
           analysis.get('gc_content', 0),
           analysis.get('molecular_weight', 0) / 1000
       ]
      
       fig.add_trace(
           go.Scatter(x=properties, y=prop_values, mode="markers+lines",
                     marker=dict(size=10, color="purple"), name="Properties"),
           row=2, col=1
       )
      
       fig.update_layout(
           title=f"Comprehensive Analysis: {sequence_id}",
           showlegend=False,
           height=600
       )
      
       fig.show()
  
   def perform_multiple_sequence_alignment(self, sequence_ids):
       if len(sequence_ids) < 2:
           return None
      
       sequences = []
       for seq_id in sequence_ids:
           if seq_id in self.sequences:
               sequences.append(self.sequences[seq_id])
      
       if len(sequences) < 2:
           return None
      
       from Bio.Align import PairwiseAligner
       aligner = PairwiseAligner()
       aligner.match_score = 2
       aligner.mismatch_score = -1
       aligner.open_gap_score = -2
       aligner.extend_gap_score = -0.5
      
       alignments = []
       for i in range(len(sequences)):
           for j in range(i+1, len(sequences)):
               alignment = aligner.align(sequences[i].seq, sequences[j].seq)[0]
               alignments.append(alignment)
      
       return alignments
  
   def create_phylogenetic_tree(self, alignment_key=None, sequences=None):
       if alignment_key and alignment_key in self.alignments:
           alignment = self.alignments[alignment_key]
       elif sequences:
           records = []
           for i, seq in enumerate(sequences):
               record = SeqRecord(Seq(seq), id=f"seq_{i}")
               records.append(record)
           SeqIO.write(records, "temp.fasta", "fasta")
          
           try:
               clustalw_cline = ClustalwCommandline("clustalw2", infile="temp.fasta")
               stdout, stderr = clustalw_cline()
               alignment = AlignIO.read("temp.aln", "clustal")
               os.remove("temp.fasta")
               os.remove("temp.aln")
               os.remove("temp.dnd")
           except:
               return None
       else:
           return None
      
       calculator = DistanceCalculator('identity')
       dm = calculator.get_distance(alignment)
      
       constructor = DistanceTreeConstructor()
       tree = constructor.upgma(dm)
      
       tree_key = f"tree_{len(self.trees)}"
       self.trees[tree_key] = tree
      
       return tree
  
   def visualize_tree(self, tree):
       fig, ax = plt.subplots(figsize=(10, 6))
       Phylo.draw(tree, axes=ax)
       plt.title("Phylogenetic Tree")
       plt.tight_layout()
       plt.show()
  
   def protein_structure_analysis(self, sequence_id):
       if sequence_id not in self.sequences:
           return None
      
       seq = self.sequences[sequence_id].seq
      
       try:
           if len(seq) % 3 == 0:
               protein = seq.translate()
               if '*' not in str(protein)[:-1]:
                   prot_analysis = ProteinAnalysis(str(protein)[:-1])
                  
                   structure_analysis = {
                       'molecular_weight': prot_analysis.molecular_weight(),
                       'isoelectric_point': prot_analysis.isoelectric_point(),
                       'amino_acid_percent': prot_analysis.get_amino_acids_percent(),
                       'secondary_structure': prot_analysis.secondary_structure_fraction(),
                       'flexibility': prot_analysis.flexibility(),
                       'gravy': prot_analysis.gravy()
                   }
                  
                   return structure_analysis
       except:
           pass
      
       return None
  
   def comparative_analysis(self, sequence_ids):
       results = []
      
       for seq_id in sequence_ids:
           if seq_id in self.analysis_results:
               analysis = self.analysis_results[seq_id].copy()
               analysis['sequence_id'] = seq_id
               results.append(analysis)
      
       df = pd.DataFrame(results)
      
       if len(df) > 1:
           fig = make_subplots(
               rows=2, cols=2,
               subplot_titles=("Length Comparison", "GC Content", "Molecular Weight", "Composition Heatmap")
           )
          
           fig.add_trace(
               go.Bar(x=df['sequence_id'], y=df['length'], name="Length"),
               row=1, col=1
           )
          
           if 'gc_content' in df.columns:
               fig.add_trace(
                   go.Scatter(x=df['sequence_id'], y=df['gc_content'], mode="markers+lines", name="GC%"),
                   row=1, col=2
               )
          
           if 'molecular_weight' in df.columns:
               fig.add_trace(
                   go.Bar(x=df['sequence_id'], y=df['molecular_weight'], name="MW"),
                   row=2, col=1
               )
          
           fig.update_layout(title="Comparative Sequence Analysis", height=600)
           fig.show()
      
       return df
  
   def codon_usage_analysis(self, sequence_id):
       if sequence_id not in self.sequences:
           return None
      
       seq = self.sequences[sequence_id].seq
      
       if len(seq) % 3 != 0:
           return None
      
       codons = {}
       for i in range(0, len(seq) - 2, 3):
           codon = str(seq[i:i+3])
           codons[codon] = codons.get(codon, 0) + 1
      
       codon_df = pd.DataFrame(list(codons.items()), columns=['Codon', 'Count'])
       codon_df = codon_df.sort_values('Count', ascending=False)
      
       fig = px.bar(codon_df.head(20), x='Codon', y='Count',
                    title=f"Top 20 Codon Usage - {sequence_id}")
       fig.show()
      
       return codon_df
  
   def motif_search(self, sequence_id, motif_pattern):
       if sequence_id not in self.sequences:
           return []
      
       seq = str(self.sequences[sequence_id].seq)
       positions = []
      
       for i in range(len(seq) - len(motif_pattern) + 1):
           if seq[i:i+len(motif_pattern)] == motif_pattern:
               positions.append(i)
      
       return positions
  
   def gc_content_window(self, sequence_id, window_size=100):
       if sequence_id not in self.sequences:
           return None
      
       seq = self.sequences[sequence_id].seq
       gc_values = []
       positions = []
      
       for i in range(0, len(seq) - window_size + 1, window_size//4):
           window = seq[i:i+window_size]
           gc_values.append(gc_fraction(window) * 100)
           positions.append(i + window_size//2)
      
       fig = go.Figure()
       fig.add_trace(go.Scatter(x=positions, y=gc_values, mode="lines+markers",
                               name=f'GC Content (window={window_size})'))
       fig.update_layout(
           title=f"GC Content Sliding Window Analysis - {sequence_id}",
           xaxis_title="Position",
           yaxis_title="GC Content (%)"
       )
       fig.show()
      
       return positions, gc_values
  
   def run_comprehensive_analysis(self, sequence_ids):
       results = {}
      
       for seq_id in sequence_ids:
           if seq_id in self.sequences:
               analysis = self.analyze_sequence(seq_id)
               self.visualize_composition(seq_id)
              
               gc_analysis = self.gc_content_window(seq_id)
               codon_analysis = self.codon_usage_analysis(seq_id)
              
               results[seq_id] = {
                   'basic_analysis': analysis,
                   'gc_window': gc_analysis,
                   'codon_usage': codon_analysis
               }
      
       if len(sequence_ids) > 1:
           comparative_df = self.comparative_analysis(sequence_ids)
           results['comparative'] = comparative_df
      
       return results

[ad_2]

Source_link

READ ALSO

Cohere Releases North Small Translate: A 218B MoE Translation Model That Scores 83.6 on WMT26 Across 50 Languages

OpenAI Launches ChatGPT for Financial Services With Built-In Data – Unite.AI

Related Posts

Cohere Releases North Small Translate: A 218B MoE Translation Model That Scores 83.6 on WMT26 Across 50 Languages
Al, Analytics and Automation

Cohere Releases North Small Translate: A 218B MoE Translation Model That Scores 83.6 on WMT26 Across 50 Languages

September 11, 2026
OpenAI Launches ChatGPT for Financial Services With Built-In Data – Unite.AI
Al, Analytics and Automation

OpenAI Launches ChatGPT for Financial Services With Built-In Data – Unite.AI

September 11, 2026
DeepSeek AI Released DeepSeek-V4.1-Flash with 1M Context, FP4 KV Cache, and Cross-Layer Attention Reuse
Al, Analytics and Automation

DeepSeek AI Released DeepSeek-V4.1-Flash with 1M Context, FP4 KV Cache, and Cross-Layer Attention Reuse

September 10, 2026
Security Video Annotation Guide: GDPR-Compliant Labeling
Al, Analytics and Automation

Security Video Annotation Guide: GDPR-Compliant Labeling

September 10, 2026
Anthropic Discloses Fourth Cyber Incident in Alignment Assessment – Unite.AI
Al, Analytics and Automation

Anthropic Discloses Fourth Cyber Incident in Alignment Assessment – Unite.AI

September 10, 2026
MIT Schwarzman College of Computing launches pilot to help educators teach AI across disciplines | MIT News
Al, Analytics and Automation

MIT Schwarzman College of Computing launches pilot to help educators teach AI across disciplines | MIT News

September 10, 2026
Next Post
How to Add WIRED as a Preferred Source on Google (2025)

How to Add WIRED as a Preferred Source on Google (2025)

POPULAR NEWS

Trump ends trade talks with Canada over a digital services tax

Trump ends trade talks with Canada over a digital services tax

June 28, 2025
15 Trending Songs on TikTok in 2025 (+ How to Use Them)

15 Trending Songs on TikTok in 2025 (+ How to Use Them)

June 18, 2025
Communication Effectiveness Skills For Business Leaders

Communication Effectiveness Skills For Business Leaders

June 10, 2025
Comparing the Top 7 Large Language Models LLMs/Systems for Coding in 2025

Comparing the Top 7 Large Language Models LLMs/Systems for Coding in 2025

November 4, 2025
App Development Cost in Singapore: Pricing Breakdown & Insights

App Development Cost in Singapore: Pricing Breakdown & Insights

June 22, 2025

EDITOR'S PICK

Experts Discuss Measurement and Brand Safety Risks

Experts Discuss Measurement and Brand Safety Risks

March 27, 2026
Agentic Workflow vs. Autonomous Agent: What’s the Difference?

Agentic Workflow vs. Autonomous Agent: What’s the Difference?

July 11, 2026
Connected TV: Opportunities, Limitations and Where It Belongs in UA December 2025 (Updated)

Connected TV: Opportunities, Limitations and Where It Belongs in UA December 2025 (Updated)

December 18, 2025
Agentic AI for Customer Engagement 2025 Guide- Agent One

Agentic AI for Customer Engagement 2025 Guide- Agent One

June 1, 2025

About

We bring you the best Premium WordPress Themes that perfect for news, magazine, personal blog, etc. Check our landing page for details.

Follow us

Categories

  • Account Based Marketing
  • Ad Management
  • Al, Analytics and Automation
  • Brand Management
  • Channel Marketing
  • Digital Marketing
  • Direct Marketing
  • Event Management
  • Google Marketing
  • Marketing Attribution and Consulting
  • Marketing Automation
  • Mobile Marketing
  • PR Solutions
  • Social Media Management
  • Technology And Software
  • Uncategorized

Recent Posts

  • Cohere Releases North Small Translate: A 218B MoE Translation Model That Scores 83.6 on WMT26 Across 50 Languages
  • The Changing Role of Digital PR in AI Search Landscape
  • How These XL Phones Compete
  • Corporate Event Registration Software: A Practical Guide
  • About Us
  • Disclaimer
  • Contact Us
  • Privacy Policy
No Result
View All Result
  • Technology And Software
    • Account Based Marketing
    • Channel Marketing
    • Marketing Automation
      • Al, Analytics and Automation
      • Ad Management
  • Digital Marketing
    • Social Media Management
    • Google Marketing
  • Direct Marketing
    • Brand Management
    • Marketing Attribution and Consulting
  • Mobile Marketing
  • Event Management
  • PR Solutions