• About Us
  • Disclaimer
  • Contact Us
  • Privacy Policy
Wednesday, March 11, 2026
mGrowTech
No Result
View All Result
  • Technology And Software
    • Account Based Marketing
    • Channel Marketing
    • Marketing Automation
      • Al, Analytics and Automation
      • Ad Management
  • Digital Marketing
    • Social Media Management
    • Google Marketing
  • Direct Marketing
    • Brand Management
    • Marketing Attribution and Consulting
  • Mobile Marketing
  • Event Management
  • PR Solutions
  • Technology And Software
    • Account Based Marketing
    • Channel Marketing
    • Marketing Automation
      • Al, Analytics and Automation
      • Ad Management
  • Digital Marketing
    • Social Media Management
    • Google Marketing
  • Direct Marketing
    • Brand Management
    • Marketing Attribution and Consulting
  • Mobile Marketing
  • Event Management
  • PR Solutions
No Result
View All Result
mGrowTech
No Result
View All Result
Home Al, Analytics and Automation

How to Create a Bioinformatics AI Agent Using Biopython for DNA and Protein Analysis

Josh by Josh
September 8, 2025
in Al, Analytics and Automation
0
How to Create a Bioinformatics AI Agent Using Biopython for DNA and Protein Analysis


class BioPythonAIAgent:
   def __init__(self, email="[email protected]"):
       self.email = email
       Entrez.email = email
       self.sequences = {}
       self.analysis_results = {}
       self.alignments = {}
       self.trees = {}
  
   def fetch_sequence_from_ncbi(self, accession_id, db="nucleotide", rettype="fasta"):
       try:
           handle = Entrez.efetch(db=db, id=accession_id, rettype=rettype, retmode="text")
           record = SeqIO.read(handle, "fasta")
           handle.close()
           self.sequences[accession_id] = record
           return record
       except Exception as e:
           print(f"Error fetching sequence: {str(e)}")
           return None
  
   def create_sample_sequences(self):
       covid_spike = "MFVFLVLLPLVSSQCVNLTTRTQLPPAYTNSFTRGVYYPDKVFRSSVLHSTQDLFLPFFSNVTWFHAIHVSGTNGTKRFDNPVLPFNDGVYFASTEKSNIIRGWIFGTTLDSKTQSLLIVNNATNVVIKVCEFQFCNDPFLGVYYHKNNKSWMESEFRVYSSANNCTFEYVSQPFLMDLEGKQGNFKNLREFVFKNIDGYFKIYSKHTPINLVRDLPQGFSALEPLVDLPIGINITRFQTLLALHRSYLTPGDSSSGWTAGAAAYYVGYLQPRTFLLKYNENGTITDAVDCALDPLSETKCTLKSFTVEKGIYQTSNFRVQPTESIVRFPNITNLCPFGEVFNATRFASVYAWNRKRISNCVADYSVLYNSASFSTFKCYGVSPTKLNDLCFTNVYADSFVIRGDEVRQIAPGQTGKIADYNYKLPDDFTGCVIAWNSNNLDSKVGGNYNYLYRLFRKSNLKPFERDISTEIYQAGSTPCNGVEGFNCYFPLQSYGFQPTNGVGYQPYRVVVLSFELLHAPATVCGPKKSTNLVKNKCVNFNFNGLTGTGVLTESNKKFLPFQQFGRDIADTTDAVRDPQTLEILDITPCSFGGVSVITPGTNTSNQVAVLYQDVNCTEVPVAIHADQLTPTWRVYSTGSNVFQTRAGCLIGAEHVNNSYECDIPIGAGICASYQTQTNSPRRARSVASQSIIAYTMSLGAENSVAYSNNSIAIPTNFTISVTTEILPVSMTKTSVDCTMYICGDSTECSNLLLQYGSFCTQLNRALTGIAVEQDKNTQEVFAQVKQIYKTPPIKDFGGFNFSQILPDPSKPSKRSFIEDLLFNKVTLADAGFIKQYGDCLGDIAARDLICAQKFNGLTVLPPLLTDEMIAQYTSALLAGTITSGWTFGAGAALQIPFAMQMAYRFNGIGVTQNVLYENQKLIANQFNSAIGKIQDSLSSTASALGKLQDVVNQNAQALNTLVKQLSSNFGAISSVLNDILSRLDKVEAEVQIDRLITGRLQSLQTYVTQQLIRAAEIRASANLAATKMSECVLGQSKRVDFCGKGYHLMSFPQSAPHGVVFLHVTYVPAQEKNFTTAPAICHDGKAHFPREGVFVSNGTHWFVTQRNFYEPQIITTDNTFVSGNCDVVIGIVNNTVYDPLQPELDSFKEELDKYFKNHTSPDVDLGDISGINASVVNIQKEIDRLNEVAKNLNESLIDLQELGKYEQYIKWPWYIWLGFIAGLIAIVMVTIMLCCMTSCCSCLKGCCSCGSCCKFDEDDSEPVLKGVKLHYT"
      
       human_insulin = "MALWMRLLPLLALLALWGPDPAAAFVNQHLCGSHLVEALYLVCGERGFFYTPKTRREAEDLQVGQVELGGGPGAGSLQPLALEGSLQKRGIVEQCCTSICSLYQLENYCN"
      
       e_coli_16s = "AAATTGAAGAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGAAGCAGCTTGCTGCTTTGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAATGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGCGTTAAGGTTAATAACCTTGGCGATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACAAAGACTGACGCTCAGGTGCGAAAGCGTGGGGAGCAAACA"
      
       sample_sequences = [
           ("COVID_Spike", covid_spike, "SARS-CoV-2 Spike Protein"),
           ("Human_Insulin", human_insulin, "Human Insulin Precursor"),
           ("E_coli_16S", e_coli_16s, "E. coli 16S rRNA")
       ]
      
       for seq_id, seq_str, desc in sample_sequences:
           record = SeqRecord(Seq(seq_str), id=seq_id, description=desc)
           self.sequences[seq_id] = record
      
       return sample_sequences
  
   def analyze_sequence(self, sequence_id=None, sequence=None):
       if sequence_id and sequence_id in self.sequences:
           seq_record = self.sequences[sequence_id]
           seq = seq_record.seq
           description = seq_record.description
       elif sequence:
           seq = Seq(sequence)
           description = "Custom sequence"
       else:
           return None
      
       analysis = {
           'length': len(seq),
           'composition': {}
       }
      
       for base in ['A', 'T', 'G', 'C']:
           analysis['composition'][base] = seq.count(base)
      
       if 'A' in analysis['composition'] and 'T' in analysis['composition']:
           analysis['gc_content'] = round(gc_fraction(seq) * 100, 2)
           try:
               analysis['molecular_weight'] = round(molecular_weight(seq, seq_type="DNA"), 2)
           except:
               analysis['molecular_weight'] = len(seq) * 650
      
       try:
           if len(seq) % 3 == 0:
               protein = seq.translate()
               analysis['translation'] = str(protein)
               analysis['stop_codons'] = protein.count('*')
              
               if '*' not in str(protein)[:-1]:
                   prot_analysis = ProteinAnalysis(str(protein)[:-1])
                   analysis['protein_mw'] = round(prot_analysis.molecular_weight(), 2)
                   analysis['isoelectric_point'] = round(prot_analysis.isoelectric_point(), 2)
                   analysis['protein_composition'] = prot_analysis.get_amino_acids_percent()
       except:
           pass
      
       key = sequence_id if sequence_id else "custom"
       self.analysis_results[key] = analysis
      
       return analysis
  
   def visualize_composition(self, sequence_id):
       if sequence_id not in self.analysis_results:
           return
      
       analysis = self.analysis_results[sequence_id]
      
       fig = make_subplots(
           rows=2, cols=2,
           specs=[[{"type": "pie"}, {"type": "bar"}],
                  [{"colspan": 2}, None]],
           subplot_titles=("Nucleotide Composition", "Base Count", "Sequence Properties")
       )
      
       labels = list(analysis['composition'].keys())
       values = list(analysis['composition'].values())
      
       fig.add_trace(
           go.Pie(labels=labels, values=values, name="Composition"),
           row=1, col=1
       )
      
       fig.add_trace(
           go.Bar(x=labels, y=values, name="Count", marker_color=['red', 'blue', 'green', 'orange']),
           row=1, col=2
       )
      
       properties = ['Length', 'GC%', 'MW (kDa)']
       prop_values = [
           analysis['length'],
           analysis.get('gc_content', 0),
           analysis.get('molecular_weight', 0) / 1000
       ]
      
       fig.add_trace(
           go.Scatter(x=properties, y=prop_values, mode="markers+lines",
                     marker=dict(size=10, color="purple"), name="Properties"),
           row=2, col=1
       )
      
       fig.update_layout(
           title=f"Comprehensive Analysis: {sequence_id}",
           showlegend=False,
           height=600
       )
      
       fig.show()
  
   def perform_multiple_sequence_alignment(self, sequence_ids):
       if len(sequence_ids) < 2:
           return None
      
       sequences = []
       for seq_id in sequence_ids:
           if seq_id in self.sequences:
               sequences.append(self.sequences[seq_id])
      
       if len(sequences) < 2:
           return None
      
       from Bio.Align import PairwiseAligner
       aligner = PairwiseAligner()
       aligner.match_score = 2
       aligner.mismatch_score = -1
       aligner.open_gap_score = -2
       aligner.extend_gap_score = -0.5
      
       alignments = []
       for i in range(len(sequences)):
           for j in range(i+1, len(sequences)):
               alignment = aligner.align(sequences[i].seq, sequences[j].seq)[0]
               alignments.append(alignment)
      
       return alignments
  
   def create_phylogenetic_tree(self, alignment_key=None, sequences=None):
       if alignment_key and alignment_key in self.alignments:
           alignment = self.alignments[alignment_key]
       elif sequences:
           records = []
           for i, seq in enumerate(sequences):
               record = SeqRecord(Seq(seq), id=f"seq_{i}")
               records.append(record)
           SeqIO.write(records, "temp.fasta", "fasta")
          
           try:
               clustalw_cline = ClustalwCommandline("clustalw2", infile="temp.fasta")
               stdout, stderr = clustalw_cline()
               alignment = AlignIO.read("temp.aln", "clustal")
               os.remove("temp.fasta")
               os.remove("temp.aln")
               os.remove("temp.dnd")
           except:
               return None
       else:
           return None
      
       calculator = DistanceCalculator('identity')
       dm = calculator.get_distance(alignment)
      
       constructor = DistanceTreeConstructor()
       tree = constructor.upgma(dm)
      
       tree_key = f"tree_{len(self.trees)}"
       self.trees[tree_key] = tree
      
       return tree
  
   def visualize_tree(self, tree):
       fig, ax = plt.subplots(figsize=(10, 6))
       Phylo.draw(tree, axes=ax)
       plt.title("Phylogenetic Tree")
       plt.tight_layout()
       plt.show()
  
   def protein_structure_analysis(self, sequence_id):
       if sequence_id not in self.sequences:
           return None
      
       seq = self.sequences[sequence_id].seq
      
       try:
           if len(seq) % 3 == 0:
               protein = seq.translate()
               if '*' not in str(protein)[:-1]:
                   prot_analysis = ProteinAnalysis(str(protein)[:-1])
                  
                   structure_analysis = {
                       'molecular_weight': prot_analysis.molecular_weight(),
                       'isoelectric_point': prot_analysis.isoelectric_point(),
                       'amino_acid_percent': prot_analysis.get_amino_acids_percent(),
                       'secondary_structure': prot_analysis.secondary_structure_fraction(),
                       'flexibility': prot_analysis.flexibility(),
                       'gravy': prot_analysis.gravy()
                   }
                  
                   return structure_analysis
       except:
           pass
      
       return None
  
   def comparative_analysis(self, sequence_ids):
       results = []
      
       for seq_id in sequence_ids:
           if seq_id in self.analysis_results:
               analysis = self.analysis_results[seq_id].copy()
               analysis['sequence_id'] = seq_id
               results.append(analysis)
      
       df = pd.DataFrame(results)
      
       if len(df) > 1:
           fig = make_subplots(
               rows=2, cols=2,
               subplot_titles=("Length Comparison", "GC Content", "Molecular Weight", "Composition Heatmap")
           )
          
           fig.add_trace(
               go.Bar(x=df['sequence_id'], y=df['length'], name="Length"),
               row=1, col=1
           )
          
           if 'gc_content' in df.columns:
               fig.add_trace(
                   go.Scatter(x=df['sequence_id'], y=df['gc_content'], mode="markers+lines", name="GC%"),
                   row=1, col=2
               )
          
           if 'molecular_weight' in df.columns:
               fig.add_trace(
                   go.Bar(x=df['sequence_id'], y=df['molecular_weight'], name="MW"),
                   row=2, col=1
               )
          
           fig.update_layout(title="Comparative Sequence Analysis", height=600)
           fig.show()
      
       return df
  
   def codon_usage_analysis(self, sequence_id):
       if sequence_id not in self.sequences:
           return None
      
       seq = self.sequences[sequence_id].seq
      
       if len(seq) % 3 != 0:
           return None
      
       codons = {}
       for i in range(0, len(seq) - 2, 3):
           codon = str(seq[i:i+3])
           codons[codon] = codons.get(codon, 0) + 1
      
       codon_df = pd.DataFrame(list(codons.items()), columns=['Codon', 'Count'])
       codon_df = codon_df.sort_values('Count', ascending=False)
      
       fig = px.bar(codon_df.head(20), x='Codon', y='Count',
                    title=f"Top 20 Codon Usage - {sequence_id}")
       fig.show()
      
       return codon_df
  
   def motif_search(self, sequence_id, motif_pattern):
       if sequence_id not in self.sequences:
           return []
      
       seq = str(self.sequences[sequence_id].seq)
       positions = []
      
       for i in range(len(seq) - len(motif_pattern) + 1):
           if seq[i:i+len(motif_pattern)] == motif_pattern:
               positions.append(i)
      
       return positions
  
   def gc_content_window(self, sequence_id, window_size=100):
       if sequence_id not in self.sequences:
           return None
      
       seq = self.sequences[sequence_id].seq
       gc_values = []
       positions = []
      
       for i in range(0, len(seq) - window_size + 1, window_size//4):
           window = seq[i:i+window_size]
           gc_values.append(gc_fraction(window) * 100)
           positions.append(i + window_size//2)
      
       fig = go.Figure()
       fig.add_trace(go.Scatter(x=positions, y=gc_values, mode="lines+markers",
                               name=f'GC Content (window={window_size})'))
       fig.update_layout(
           title=f"GC Content Sliding Window Analysis - {sequence_id}",
           xaxis_title="Position",
           yaxis_title="GC Content (%)"
       )
       fig.show()
      
       return positions, gc_values
  
   def run_comprehensive_analysis(self, sequence_ids):
       results = {}
      
       for seq_id in sequence_ids:
           if seq_id in self.sequences:
               analysis = self.analyze_sequence(seq_id)
               self.visualize_composition(seq_id)
              
               gc_analysis = self.gc_content_window(seq_id)
               codon_analysis = self.codon_usage_analysis(seq_id)
              
               results[seq_id] = {
                   'basic_analysis': analysis,
                   'gc_window': gc_analysis,
                   'codon_usage': codon_analysis
               }
      
       if len(sequence_ids) > 1:
           comparative_df = self.comparative_analysis(sequence_ids)
           results['comparative'] = comparative_df
      
       return results



Source_link

READ ALSO

A better method for planning complex visual tasks | MIT News

Google AI Introduces Gemini Embedding 2: A Multimodal Embedding Model that Lets Your Bring Text, Images, Video, Audio, and Docs into the Embedding Space

Related Posts

A better method for planning complex visual tasks | MIT News
Al, Analytics and Automation

A better method for planning complex visual tasks | MIT News

March 11, 2026
Google AI Introduces Gemini Embedding 2: A Multimodal Embedding Model that Lets Your Bring Text, Images, Video, Audio, and Docs into the Embedding Space
Al, Analytics and Automation

Google AI Introduces Gemini Embedding 2: A Multimodal Embedding Model that Lets Your Bring Text, Images, Video, Audio, and Docs into the Embedding Space

March 11, 2026
AI Is Learning From the News. Now Publishers Want to Get Paid
Al, Analytics and Automation

AI Is Learning From the News. Now Publishers Want to Get Paid

March 11, 2026
3 Questions: Building predictive models to characterize tumor progression | MIT News
Al, Analytics and Automation

3 Questions: Building predictive models to characterize tumor progression | MIT News

March 10, 2026
Al, Analytics and Automation

How to Build a Risk-Aware AI Agent with Internal Critic, Self-Consistency Reasoning, and Uncertainty Estimation for Reliable Decision-Making

March 10, 2026
marvn.ai and the rise of vertical AI search engines
Al, Analytics and Automation

marvn.ai and the rise of vertical AI search engines

March 10, 2026
Next Post
How to Add WIRED as a Preferred Source on Google (2025)

How to Add WIRED as a Preferred Source on Google (2025)

POPULAR NEWS

Trump ends trade talks with Canada over a digital services tax

Trump ends trade talks with Canada over a digital services tax

June 28, 2025
Communication Effectiveness Skills For Business Leaders

Communication Effectiveness Skills For Business Leaders

June 10, 2025
15 Trending Songs on TikTok in 2025 (+ How to Use Them)

15 Trending Songs on TikTok in 2025 (+ How to Use Them)

June 18, 2025
App Development Cost in Singapore: Pricing Breakdown & Insights

App Development Cost in Singapore: Pricing Breakdown & Insights

June 22, 2025
Google announced the next step in its nuclear energy plans 

Google announced the next step in its nuclear energy plans 

August 20, 2025

EDITOR'S PICK

Why CIOs must lead AI experimentation, not just govern it

Why CIOs must lead AI experimentation, not just govern it

December 28, 2025
Jensen Huang Says Nvidia’s New Vera Rubin Chips Are in ‘Full Production’

Jensen Huang Says Nvidia’s New Vera Rubin Chips Are in ‘Full Production’

January 6, 2026

Communicators say these are the hills they’ll die on

January 25, 2026
Microsoft says it will no longer use engineers in China for Department of Defense work

Microsoft says it will no longer use engineers in China for Department of Defense work

July 20, 2025

About

We bring you the best Premium WordPress Themes that perfect for news, magazine, personal blog, etc. Check our landing page for details.

Follow us

Categories

  • Account Based Marketing
  • Ad Management
  • Al, Analytics and Automation
  • Brand Management
  • Channel Marketing
  • Digital Marketing
  • Direct Marketing
  • Event Management
  • Google Marketing
  • Marketing Attribution and Consulting
  • Marketing Automation
  • Mobile Marketing
  • PR Solutions
  • Social Media Management
  • Technology And Software
  • Uncategorized

Recent Posts

  • A better method for planning complex visual tasks | MIT News
  • When Clickbait Becomes a Lesson
  • Google completes acquisition of Wiz
  • 9 Best Free SEO Courses in 2026
  • About Us
  • Disclaimer
  • Contact Us
  • Privacy Policy
No Result
View All Result
  • Technology And Software
    • Account Based Marketing
    • Channel Marketing
    • Marketing Automation
      • Al, Analytics and Automation
      • Ad Management
  • Digital Marketing
    • Social Media Management
    • Google Marketing
  • Direct Marketing
    • Brand Management
    • Marketing Attribution and Consulting
  • Mobile Marketing
  • Event Management
  • PR Solutions